===============================
4. BLASTing your assembled data
===============================
.. shell start

One thing everyone wants to do is BLAST sequence data, right?  Here's a
simple way to set up a stylish little BLAST server that lets you search
your newly assembled sequences.

Installing blastkit
-------------------

Installing some prerequisites:
::

   pip install pygr whoosh Pillow Jinja2 \
       git+https://github.com/ctb/pygr-draw.git screed
   apt-get -y install lighttpd blast2
   ln -s /usr/bin/blastall /usr/local/bin/

and configure them:
::

   cd /etc/lighttpd/conf-enabled
   ln -fs ../conf-available/10-cgi.conf ./
   echo 'cgi.assign = ( ".cgi" => "" )' >> 10-cgi.conf
   echo 'index-file.names += ( "index.cgi" ) ' >> 10-cgi.conf

   /etc/init.d/lighttpd restart

Next install blastkit:
::

   cd /root
   git clone https://github.com/ctb/blastkit.git -b ec2
   cd blastkit/www
   ln -fs $PWD /var/www/blastkit

   mkdir files
   chmod a+rxwt files
   chmod +x /root

and run check.py:
::

   cd /root/blastkit
   python ./check.py

It should say everything is OK.

Adding the data
---------------

If you've just finished a transcriptome assembly (:doc:`3-big-assembly`) then
you can do this to copy your newly generated assembly into the right place:
::

   cd /mnt/work
   cp trinity_out_dir/Trinity.fasta /root/blastkit/db/db.fa

Alternatively, you can grab my version of the assembly (from running this
tutorial):
::

   cd /root/blastkit
   curl -O https://s3.amazonaws.com/public.ged.msu.edu/trinity-nematostella-raw.fa.gz
   gunzip trinity-nematostella-raw.fa.gz 
   mv trinity-nematostella-raw.fa db/db.fa

Formatting the database
~~~~~~~~~~~~~~~~~~~~~~~

After you've done either of the above, format and install the database
for blastkit:
::

   cd /root/blastkit
   formatdb -i db/db.fa -o T -p F
   python index-db.py db/db.fa

Done!

.. note::

   You can install any file of DNA sequences you want this way; just copy
   it into /root/blastkit/db/db.fa and run the indexing commands, above.

Running blastkit
----------------

Figure out what your machine name is
(ec2-???-???-???-???.compute-1.amazonaws.com) and go to::

    http://machine-name/blastkit/

Make sure you have enabled port 80 in your security settings on Amazon.

(If you're using the Nematostella data set, try this sequence::

   CAGCCTTTAGAAGGAAACAGTGGCAATATATAATTCTAGATGAAGCTCAGAATATCAAAA
   ATTTTAAAAGTCAAAGGTGGCAGTTGCTGTTGAATTTTTCAAGTCAGAGGAGACTTTTGT
   TGACTGGAACACCTTTGCAGAACAATTTGATGGAGCTGTGGTCGCTTATGCATTTCCTCA
   TGCCATCAATGTTTGCTTCTCATAAAGATTTTAGGGAGTGGTTTTCTAACCCTGTTACAG
   GGATGATTGAAGGGAATTCAG

It should match something in your assembly.)

Next: :doc:`5-building-transcript-families`