BLASTing your assembled data

One thing everyone wants to do is BLAST sequence data, right? Here’s a simple way to set up a stylish little BLAST server that lets you search your newly assembled sequences.

Installing blastkit

Installing some prerequisites:

pip install pygr
pip install whoosh
pip install git+https://github.com/ctb/pygr-draw.git
pip install git+https://github.com/ged-lab/screed.git
apt-get -y install lighttpd

and configure them:

cd /etc/lighttpd/conf-enabled
ln -fs ../conf-available/10-cgi.conf ./
echo 'cgi.assign = ( ".cgi" => "" )' >> 10-cgi.conf
echo 'index-file.names += ( "index.cgi" ) ' >> 10-cgi.conf

/etc/init.d/lighttpd restart

Next, install BLAST:

cd /root

curl -O ftp://ftp.ncbi.nih.gov/blast/executables/release/2.2.24/blast-2.2.24-x64-linux.tar.gz
tar xzf blast-2.2.24-x64-linux.tar.gz
cp blast-2.2.24/bin/* /usr/local/bin
cp -r blast-2.2.24/data /usr/local/blast-data

And put in blastkit:

cd /root
git clone https://github.com/ctb/blastkit.git -b ec2
cd blastkit/www
ln -fs $PWD /var/www/blastkit

mkdir files
chmod a+rxwt files
chmod +x /root

and run check.py:

cd /root/blastkit
python ./check.py

It should say everything is OK.

Adding the data

If you’ve just finished a transcriptome assembly (3. Running the Actual Assembly) then you can do this to copy your newly generated assembly into the right place:

cp trinity_out_dir/Trinity.fasta /root/blastkit/db/db.fa

Alternatively, you can grab my version of the assembly (from running this tutorial):

cd /root/blastkit
curl -O https://s3.amazonaws.com/public.ged.msu.edu/trinity-nematostella-raw.fa.gz
gunzip trinity-nematostella-raw.fa.gz
mv trinity-nematostella-raw.fa db/db.fa

Formatting the database

After you’ve done either of the above, format and install the database for blastkit:

cd /root/blastkit
formatdb -i db/db.fa -o T -p F
python index-db.py db/db.fa

Done!

Note

You can install any file of DNA sequences you want this way; just copy it into /root/blastkit/db/db.fa and run the indexing commands, above.

Running blastkit

Figure out what your machine name is (ec2-???-???-???-???.compute-1.amazonaws.com) and go to:

http://machine-name/blastkit/

Make sure you have enabled port 80 in your security settings on Amazon.

(If you’re using the Nematostella data set, try this sequence:

CAGCCTTTAGAAGGAAACAGTGGCAATATATAATTCTAGATGAAGCTCAGAATATCAAAA
ATTTTAAAAGTCAAAGGTGGCAGTTGCTGTTGAATTTTTCAAGTCAGAGGAGACTTTTGT
TGACTGGAACACCTTTGCAGAACAATTTGATGGAGCTGTGGTCGCTTATGCATTTCCTCA
TGCCATCAATGTTTGCTTCTCATAAAGATTTTAGGGAGTGGTTTTCTAACCCTGTTACAG
GGATGATTGAAGGGAATTCAG

It should match something in your assembly.)

---

LICENSE: This documentation and all textual/graphic site content is licensed under the Creative Commons - 0 License (CC0) -- fork @ github.

---

comments powered by Disqus